Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14417A3
Clone ID IST14417A3
Vector VICTR74
Project tigm

Sequence tag IST14417A3HMF1
Sequence
TTAAGCACATTTAGAAGAGAGGATTAGACCTACTTCTGGGTCACTTCGATGCCACCAAGCCCCGGTCTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI32962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 5199114..5199187 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020627 (Klhl29) kelch-like 29 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2683857]

 
Come back to gene ENSMUSG00000020627


For any suggestions or comments, please send an email to unitrap@crg.es