Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A034A08
Clone ID A034A08
Vector pT1betageo
Project ggtc

Sequence tag A034A08
Sequence
GCATAGNNNGGATTCTCTGTGAGCCGCACCTTCTGGTACACTGAATCTCCCGGGGGGCCATCCGCCCGACTGCCCCTGAC
TCCGGCAGCGGGGACCCCCCATGGCAGTGGGCACCTCCCCTTGAAACCTGCCAAGCTGGACGCCACAGCCCTGCACGACG
ACACCTCGGCCAGCTCCACGCCCATCTCTGAGGCTTGCAGCCATGCGGTCCTCGCCTGCGGCCCGGGCATCCCTGAAGAG
TACTATGTGAGCGAGGCTGTGAAGATGCTCCCAGCTACAGAGAGCACCGGGATGCCTGCACCATCACC
Sequence Type mRNA
Unitrap ID UNI6485

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121273118..121273416 295
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es