Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13613F10
Clone ID IST13613F10
Vector VICTR74
Project tigm

Sequence tag IST13613F10HMR1
Sequence
CCTTCTTCCCTTCTTATGAGACTTGAATTCGTGAAATCAACAGATTGGCTTTCTTTTTCTTTCTCTTCCAGATGCAAGCC
TCCAGGCTGAGGAAAACTGTAAGTCCTGGTATTTTCACATGGCTTCCTTCTTTGTGTCTTTTCTGAAATTAACTCATGTC
AGACTGCTTAGGGTTGGTGTTTACAACAACTAAGAAAACTCTCAAAGCCTTGTTCTAAATCAAGGTTCAAAGAGTGTGTA
TTANAGACAGCGGTGTAGGAGAAAATTGCTGAACACCAGTCTTACATCTTGGTGGGTTTCTGTTTGTTGGAATGGGAGAG
ATGGGTTTTTTTAAAAAAATTCCTTATATGTATATATGTATATATATGATTCCTTATATGTTTGTGGTCNTTCTNTCN
Sequence Type genomic DNA
Unitrap ID UNI17448

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106575917..106576313 391
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es