Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11200G4
Clone ID IST11200G4
Vector VICTR76
Project tigm

Sequence tag IST11200G4HMR1
Sequence
NNACAAGAGCTAGGTCACAGACAAAAGGAAAGGGGAGTATACTGCAGGGGTCACCGTTATGGAGAAGGACATGATACAGG
CAGTGAGAATGATTTTGTAATTTCNCAGATTGTAATACTACTAGATTAGTAATACTAGACTGATGGACTTTAATTTGGGC
AGGTTAGCTTGAGCCAATGGGGAATGAATTCCCATTTTGGATCTGTATTATGAGATATGTGTAATTATTGNTGACATATT
TAAGTGAGCTCN
Sequence Type genomic DNA
Unitrap ID UNI30717

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177358951..177359199 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078865 (OTTMUSG00000016574) predicted gene, OTTMUSG00000016574 Gene [Source:MGI Symbol;Acc:MGI:3649838]


Sequence tag IST11200G4BBF1
Sequence
GTCTGCACTGCATTACCTGACAGTGTANTCAGGAAACTGTTTCTCTCATTCTCATCATGCCGACTATATTGCCACACACA
AGCCGCAGCTACAAATGTTTGTCCAGATGCAGTCTTATAATAAAGTTACTCANAGGCCACAGTCTCGTCCAAAAGATTAG
GTCCACAAAATACCTNNCAGGTGGCCCNNNCTGTGTGGCTTCTGGGAAGACCTATTACACATGTATCCTTTTCTTTTTTT
TTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177359198..177359441 230
NO GENE  

 
Come back to gene ENSMUSG00000078865


For any suggestions or comments, please send an email to unitrap@crg.es