Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BB0350
Clone ID BB0350
Vector pGT2lxr
Project sanger

Sequence tag BB0350
Sequence
TTGTGAGGCTTTCTAGATGGTTTTTCGCCGCCATGCTCCGGGTTCCCCTTTAAGGCTGAGCGAGGTGCCACTTGAGCCGC
GCTTGCGAGCTCCGCTGCCAGGACCTGTGGGGAGAGTGCAGTCGAGATCGGAAGCCGCGCCATGGACTTGGTGACCTTTG
AGGATGTGGCTGTGAACTTCACCCAGGAAGAGTGGACTTTGCTGGATCCTTCTCAGAAGAACCTATACATTAATGTGATG
CTGGAGACCTGCAGTAACCTTGCTTCTGTGGGAATCAAATCAGAATACCAGACCATTGAAGACCAGTATAAACAGCCTGG
GAAAAATATAAG
Sequence Type mRNA
Unitrap ID UNI1837

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 46773109..46789545 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068959 (Zfp619) NM_001004139 zinc finger protein 619 Gene [Source:MGI (curated);Acc:Zfp619-001]

 
Come back to gene ENSMUSG00000068959


For any suggestions or comments, please send an email to unitrap@crg.es