Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12747G6
Clone ID IST12747G6
Vector VICTR76
Project tigm

Sequence tag IST12747G6HMF1
Sequence
CATTTTCTTTTAAAGAGGGGGCTGTGGGGGAAGTAAGCCAGAGGACGGAAGCTCTAAACATGTCTAAATGTGTCTGCAGC
AAATTCCAGGAAACCCAGGCCAGTGAGAAGCCATCCCGTGGCGGGGTGGGAAGGGTGGGAGGGTCTCTAGGACTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI32968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26363538..26363695 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026923 (Notch1) NM_008714 Notch gene homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Notch1-001]


Sequence tag IST12747G6BBF1
Sequence
CATTTNCTTTTAAAGAGGGGGCNNNNNNGGAAGTNNNNNNNANGACNGNNNNNNTNNNNNTGTNTNANTGTGTCTGCAGC
AAATTCCAGGAAACCCAGGCCAGTGAGAAGCCATCCCGTGGCGGGGTGGGAAGGGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026923


For any suggestions or comments, please send an email to unitrap@crg.es