Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14883G7
Clone ID IST14883G7
Vector VICTR76
Project tigm

Sequence tag IST14883G7HMR1
Sequence
AGAGTGTTTTAAAGTAAGTGTCTACCGACTGTGCTGGGTTTGTTATTTAATAGCTGACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32970

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 74846706..74846767 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034858 (BC031353) NP_001106754 Uncharacterized protein KIAA1370 [Source:UniProtKB/Swiss-Prot;Acc:Q69ZK7]


Sequence tag IST14883G7HMF1
Sequence
GAAGTACCTGCCATCCTAGCTAGGTTCTTTACTACTCATATATTCATTTATGTATACATGTATGTTATAACATTCTACTT
AAGCATATAGTTTTATGTTCTTAGTCATCTGCTCTGAATTTTATTTCAGGTCATTATTTTTCAAAACTGTATCGTTTTAC
AGAGACAATCCACTAACAGTTATTTTACACTTTAATTGCATGTATTGCTAACCCGGGGCTTTGTGCCTGCTAANCGCATG
CTCATCGTCTGANCTACGCCCCAACCCTCANATCAGCCATTGCTTTCTCTCTCTGTTGTATGACTTGCCCTGGANGGATG
TGANCNNATGCCNCTCCCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 98120174..98120514 323
NO GENE  


Sequence tag IST14883G7BBF1
Sequence
GAAGTACCTGCCATCCTAGCTAGGTTCTTTACTACTCATATATTCATTTATGTATACATGTATGTTATAACATTCTACTT
AAGCATATAGTTTTATGTTCTTAGTCATCTGCTCTGAATTTTATTTCAGGTCATTATTTTTCAAAACTGTATCGTTTTAC
AGAGACAATCCACTAACAGTTATTTTACACTTTAATTGCATGTATTGCTAACCCGGGGCTTTGTGCCTGCTAAGCGCATG
CTCATCGTCTGANCNNNNCCCCAACCCTCANATCAGCCATTGCTTTCTCTCTCTGTTGTATGACTTGCCCTGGAGGGATG
TGAGCNNATGCNTCTCCNCNCNNNANAANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 98120174..98120510 319
NO GENE  

 
Come back to gene ENSMUSG00000034858


For any suggestions or comments, please send an email to unitrap@crg.es