Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14958G9
Clone ID IST14958G9
Vector VICTR76
Project tigm

Sequence tag IST14958G9HMF1
Sequence
ATGAAGACCCCGGGTACTTGGTTAAGTAGGCCTCCTTGCTCCTTTCCACCCTGGGACAGTCAGAGTGTGGGCGCTCTGAG
TTGGGGGACAGTTTAACTGAGCTCTGGGGAAAACTTAGGGATCTTCTCNAGACCTCTGTCACCCCTTGACNTGGCTGACA
NATCTTNACCCCCGTGGGAGGCATTCCGCN
Sequence Type genomic DNA
Unitrap ID UNI10902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71198811..71198999 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047407 (Tgif1) NM_009372 TGFB-induced factor homeobox 1 Gene [Source:MGI (curated);Acc:Tgif1-003]


Sequence tag IST14958G9BBF1
Sequence
ATGAAAACCCNNGGTACNTGNTTAATTANGCCNCCNTGCTCCTTTCCNCCCTGGGACAGTCNNAGTGTGGGCGCTCTGAG
TTGGGGGACAGTTTANCTGAGCTCTGGGGAAAACTTANGGATCTTCTCAAGACCTCTGTCACCCCTTGACGTGGCTGACN
NATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047407


For any suggestions or comments, please send an email to unitrap@crg.es