Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A040B05
Clone ID A040B05
Vector pT1betageo
Project ggtc

Sequence tag A040B05
Sequence
CAATCNNNTTTTTANNAAAAAGCAGGAAATGGAGAGAAATGAGATCCCATTCTTGTGCCATAGCAGNNNTGACTATGCTA
AGATTCTGTGGAAGAAAGGAGAGGCCGTTGGGTTTTATTCAGTTAAGCCTACAGGAAGCTTATGTGCCTCATTTCTTACT
CAGAATTACCAACTGCCAGTTCTTGATACAATGTTTATAAGGAAGAAATACAGAGGAAAAGATTTGGGGCTTCATATGCT
GGAAGATTTTGTTGATTCCTTTACAGAAGATGCACTTGGCTTACGGTACCCACTGTCTTCTCTCATGTACACAGCTTCCA
AGCAATACTTTGAAAAGTATCCAGGAGATCATGCACTTCTTTGGGAAGTTGAAGGTGTGGGTCACTGGCATCAGCGAGTA
CCAGTCACCCGAGCATTGCAGAGATAGGCTATTAAAGCTACAG
Sequence Type mRNA
Unitrap ID UNI12217

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97867533..97880106 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es