Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12574B2
Clone ID IST12574B2
Vector VICTR76
Project tigm

Sequence tag IST12574B2HMF1
Sequence
CCCCGCACACCTGCAAAAGTGCCAACCTCAGCCCCTAGCCTGGGCAAACCCAAAAGCCCTCACAGCAGCCCGACAAAGCT
ACCCTCCAAGTCCCCCACCAAGGTGGTACCCCGCCCTGTGGTACCCTTAGGCACCAAGGAGCCCCCCAAGCCTGACAAAG
TGAAGGGCCCACCCTGGGCAGATTGTGGCAGCACAGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI32971

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 99256503..99256702 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023009 (C230021P08Rik) NM_001001884 Riken cDNA C230021P08 gene Gene [Source:MGI Symbol;Acc:MGI:3609653]


Sequence tag IST12574B2BBF1
Sequence
CCCCGCACACCTGCAAAAGTGCCAACCTCAGCCCCTAGCCTGGGCAAACCCAAAAGCCCTCACAGCAGCCCGACAAAGCT
ACCCTCCNNNNNNCCCACCAAGGTGGTACCCCGCCCTGTGGTACCCTTAGGCACCAAGGAGCCCCCCAAGCCTGACAAAG
TGAAGGGCCCACCCTGGGCAGATTGTGGCAGCACAGTTGGCCAGCCTACATCCCCAGTANCCGGCCCCGCCGACCCAAGC
CAGGGCTCANAAGGGCCAGCCCCACACTCGGCCATCGAGGANAAGGTGATGAAGGGCATTGAGGAGAACGTGCTGCGCCT
TCAAGGTCNNGAACGGACTCCGGGCTCCGAANCCNAACACCGCAACACCAGCAGCATCGCCAGCTGGTTTGGCCTTAAAA
AGANCAAGCTGCCGGCTCTGAACCGCCGCACTGN
Sequence Type genomic DNA
Unitrap ID UNI32971

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 99256270..99256702 405
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023009 (C230021P08Rik) NM_001001884 Riken cDNA C230021P08 gene Gene [Source:MGI Symbol;Acc:MGI:3609653]

 
Come back to gene ENSMUSG00000023009


For any suggestions or comments, please send an email to unitrap@crg.es