Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10920G6
Clone ID IST10920G6
Vector VICTR76
Project tigm

Sequence tag IST10920G6HMR1
Sequence
NNGTTGGTTGTTCTTTTGTTATCTTACCCAAGGNCGTGCCAGAGGAAAGAGTAAAGCCAGGGACTCTTGGTCCTGGCCAN
CT
Sequence Type genomic DNA
Unitrap ID UNI11791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114395796..114395872 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042364 (Snx18) NM_130796 sorting nexin 18 Gene [Source:MGI Symbol;Acc:MGI:2137642]


Sequence tag IST10920G6HMF1
Sequence
NNCNAACCAGAGACCAAAACGGAAGACCTAGAAAATGTCTAGCAAGAACATTAAGAGATGACCCATGCTGCACTGGTTAC
GGGTATCCCGTGGTGCAGAGCAGGAACTGAGTGCCCTGTGAGACAAAGGCATAAACCCCCAGGCTCCTGGAAGGCTCTGT
TTGTTGGTCACTGTCAAGAGCTGGAATCACTCATTTATGCTGCCAGCCTCAGGAGGCGGGGCTTTGATACCCGTTTATTT
TAGCCNGAGCCTCCCTTTACCGGTGTANATCAAAAGAAACTGGAGTTTTTCCTTTAATTANAACAATGATGGTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114395874..114396184 305
 
EST/CDNA Est Name
  BY101749.1 - CJ054654.1

 
Come back to gene BY101749.1 - CJ054654.1


For any suggestions or comments, please send an email to unitrap@crg.es