Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12539C12
Clone ID IST12539C12
Vector VICTR76
Project tigm

Sequence tag IST12539C12BBF1
Sequence
AGGCCAAACTTGTACTTATATTTTACTCATGAAAATATTGAAAGGGATGGGTATGGAGGGGAGTGTGCTGATGTTGAAGA
TGAAGGGGTGGGAGGCAGGTAGGCCAGGCTGATTGTCTATCAAACCCTGACATGTACAGTATCANATAAAGATTANATCC
GAATATTANCGTTCTCTCTGTCTGTCTGTCNGTCTGTCTGTCTATCTACTTANTTANTTACTNNNTNNNTTN
Sequence Type genomic DNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82318247..82318468 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]


Sequence tag IST12539C12HMF1
Sequence
AGGCCNAACTTGTACTTATATTTTACTCATGAAAATATTGAAAGGGATGGGTATGGAGGGGAGTGTGCTGATGTTGAANA
TGAAGGGGTGGGANGCANGTNNGCCNNGCTGATTGNCTATCANACCCNGACATGTACANTANCANATAAANATTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es