Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A049F04
Clone ID A049F04
Vector pT1betageo
Project ggtc

Sequence tag A049F04
Sequence
GGAGGCACTTGGGATCGTCCGCAGGGTTTGGGACAGCTACAGAGGCCGCCACGGAGCCCGCCGGAGCCCCCGTTCCTGCT
GGTGCTGCCGCCGCCCGAATCGGAACCGTCGGGCTGCAGCCGCCGGCAATGCCGCGAAGGAAGAGAAATGCAGGCAGTAG
TTCAGATGGAACCGAAGATTCCGATTTTTCTACAGATCTCGAGCATACAGACAGTTCAGAGAGTGATGGCACCTCGCGCC
GATCTGCCCGAGTCACCCGCTCGTCAGGCAGGCTTAAGCCAGANNTCCCAAG
Sequence Type mRNA
Unitrap ID UNI22

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95167363..95171491 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es