Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10041D8
Clone ID IST10041D8
Vector VICTR75
Project tigm

Sequence tag IST10041D8HMF1
Sequence
CCAGGACAGCCAGGGCTACACAGAAAAACCCTGTCTCAA
Sequence Type genomic DNA
Unitrap ID UNI7613 UNI27234 UNI30810 UNI32576 UNI32974 UNI32975 UNI32976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_109319: 137746..137784 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166303: 158815..158853 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166436: 198224..198262 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166440: 152438..152476 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166435: 80462..80500 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4898548..4898586 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 12299675..12299713 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024404 (Riok3) NM_024182 RIO kinase 3 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914128]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5099979..5100017 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13791135..13791173 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022682 (Rrn3) NM_001039521 RRN3 RNA polymerase I transcription factor homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1925255]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6908088..6908126 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14066857..14066895 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039242 (B3galnt2) NM_178640 UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:2145517]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 66228727..66228765 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3525052..3525090 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 34777069..34777107 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032036 (Kirrel3) NM_026324 kin of IRRE like 3 (Drosophila) Gene [Source:MGI (curated);Acc:Kirrel3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21496796..21496834 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62412850..62412888 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13090918..13090956 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038542 (Pcid2) NP_848823 PCI domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2443003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 9123573..9123611 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046178 (Nxph1) NM_008751 neurexophilin 1 Gene [Source:MGI Symbol;Acc:MGI:107492]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3363320..3363358 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 12962108..12962146 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11496513..11496551 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078773 (Rad54b) NM_001039556 RAD54 homolog B (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rad54b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9046821..9046859 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12379440..12379478 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17826411..17826449 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 25430192..25430230 39
NO GENE  

 
Come back to gene ENSMUSG00000078773


For any suggestions or comments, please send an email to unitrap@crg.es