Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A049D08
Clone ID A049D08
Vector pT1betageo
Project ggtc

Sequence tag A049D08
Sequence
TTTGCCTCAGGACCCGGCTATTGTTCAGTCTTCACTAGGTTCGTCGTCATCTTCATTCCAGTCGGTGGGTTCCTATGGCC
CTTTTGGCAGGATGCCAGCATACAGTCAGTTCAGTCCAAGTACATTAGTTGGGCAGCAGTTTGGTGCTGTTGGTGTTGCT
GGAAACTCTTTGACATCCTTTGGAACAGAAGCATCAAATAGTGGTACCTTATCCCAGAGCAATGCAGTTGGTTCGGCCTT
CACACAAGACACAAGATCTGTAAAACCACAGCTAGCCCAAG
Sequence Type mRNA
Unitrap ID UNI12219

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35150634..35160275 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066568 (Lsm14a) NM_025948 LSM14 homolog A (SCD6, S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsm14a-001]

 
Come back to gene ENSMUSG00000066568


For any suggestions or comments, please send an email to unitrap@crg.es