Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A039A02
Clone ID A039A02
Vector pT1betageo
Project ggtc

Sequence tag A039A02
Sequence
ATGCTTCATTTCTCCCTCAGGATGGACACAGGAACAGGTTTGCCGTGTTCAGAAACTCCATCATATTCTTGAAATCTTAG
TCATCTGCATGCTTTTCATTAAACCTCAGCATGAGCTTCTCTTCTCTTTAACACAATCCTGCATAAAATATTATAAACAA
AATCCTCTTGATGAGCAACACATTTTTCAGTTGCCAGTCAGACCAGCTGCTGTCAAGAATTTGTATCAAAGTGAGAAGCC
GCAGAAATGGAGAGTGGAGCTCAGCAATAGTCAGAAGAGGGTGAAAACAGTGTGGCAACTGAGTGACAGCTCCCCTGTAG
ACCATTCCAGTTTCCACAGGCC
Sequence Type mRNA
Unitrap ID UNI12220

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63991889..63995211 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032400 (Zwilch) NM_026507 Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI (curated);Acc:Zwilch-001]

 
Come back to gene ENSMUSG00000032400


For any suggestions or comments, please send an email to unitrap@crg.es