Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14273A4
Clone ID IST14273A4
Vector VICTR74
Project tigm

Sequence tag IST14273A4HMR1
Sequence
NANGAACAGAATAGACCCCTCTCTGGGAGCATGAGGAGTAGAGGGATCTCGGTAGGGAAGTTGGATCTT
Sequence Type genomic DNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59471079..59471144 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


Sequence tag IST14273A4BBF1
Sequence
CCTTCACACTGGTGTCCCCCTCACCATTATTTACACAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59471036..59471079 44
NO GENE  


Sequence tag IST14273A4HMF1
Sequence
CCTTCACACTGGTGTCCCCCTCACCATTATTTACACAGAGATCTTGACCAGTACTCTAGACAGATCCTTCCTTCTTCCTT
CTGTGTACTTATCAATCAATCACTGATTTCATCTTCTCAATCGACCCATGCTTCCCGTTCCCACCCANNGNNNNGATACT
ATCTTACCATGCAAGAGTCTGGCTGGCTTCCTGGCCTCCCTTCTCCCTTCCTACCAAGCTAACAGGAAAGAAAATTTGAC
CGAGTCCTTCCCATTAAGCCTTTCAGANGTTCCACTACCTACAGAATCAATCAGTTCTTCTTCAGCAAGGTCTCCGANGC
CCACCGATACTCACATCANGCTCTCTGANCNCCCATCTCTGGACCACCTTCCTCCTGCAATCTACCCATCCCTCTCANAT
TCNTTATAGCTCTAAATATTTCCATCCNCTGCTCATGCTGTTGCTTTGGCTACAACCCATCTGTGANGGCNAATCTTANT
TC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59470599..59471079 447
NO GENE  

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es