Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A049A05
Clone ID A049A05
Vector pT1betageo
Project ggtc

Sequence tag A049A05
Sequence
GTAGTTGAACTACAGACTACCTTGTGACCGTGTGAGCAAAGCCACCCTTGCAACCCATGTGCATCATCTTCTTTAAGTTT
GATCCTCGTCCTGTTTCCAAAAATGCATACAG
Sequence Type mRNA
Unitrap ID UNI12225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18324450..18338719 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013539 (D16H22S680E) NM_138583 Ser/Thr-rich protein T10 in DGCR region [Source:UniProtKB/Swiss-Prot;Acc:P54797]

 
Come back to gene ENSMUSG00000013539


For any suggestions or comments, please send an email to unitrap@crg.es