Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A048F03
Clone ID A048F03
Vector pT1betageo
Project ggtc

Sequence tag A048F03
Sequence
CTCGCCGCGCGGCCCAGCCAGCTCCGGAGTATTCACCTCTCCTCGCTGAGCTCTGCACCCGAGGCTACCCCTCGCGCCTT
AGGCCGACGCCATGAAGATCAAGGATGCCAAAAAACCCT
Sequence Type mRNA
Unitrap ID UNI10011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 35583331..35583449 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018846 (Pank3) NM_145962 pantothenate kinase 3 Gene [Source:MGI (curated);Acc:Pank3-001]

 
Come back to gene ENSMUSG00000018846


For any suggestions or comments, please send an email to unitrap@crg.es