Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14188G8
Clone ID IST14188G8
Vector VICTR74
Project tigm

Sequence tag IST14188G8HMR1
Sequence
AGCNNCCTTGTGGTTGCTGGGAATTGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCGGAGCCATCTCTTCAGCCCCGAG
AATTGTGTCTTGATCATCTCTGTCTTGTCC
Sequence Type genomic DNA
Unitrap ID UNI30560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125624680..125624788 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]


Sequence tag IST14188G8BBF1
Sequence
CAGANGNNNCAGCCATCCTCTCCCANGNANCATAACCNNTATCTTTTCCTTTCTGGGAAAATGCTAGCTTGGCTGATGTT
GTGACTTTCATAATGTTCTGGGCCTCAGTGGCCCATACTGATCCATGCAGTGGGAATCTAGGGAAACCGCAGTATAGGAA
CCCCAGGCTGGCAATGGTACGCATCTCCTCCTGCTCCCTTTAGGACCTGATGTCCTGAGGAATGTGTTCCCTCCCTTGCC
CTCCTCCAGTCCATGCCAATGCCACTAANACATTTTCTTTTCTGGGCACTGGGGCCCAGCCACCTGTTGTCTCTAANAAG
ANAGAAGGANCCACCCTAAACTTANCANCTGCCCTTGGCCTTCGCACAGCCCCTCCCGGCTTTAGTTGGCANCTGTTTTG
CCTTATATGGGTACCNCATATGGGTACCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134353935..134354363 395
NO GENE  


Sequence tag IST14188G8HMF2
Sequence
ACAACCATCTGTAATGGGAACTGATGCCCTCCTCTGGTGTGTCTGAAGTCAGCTACAGTGTACTCATATACATAAAATAG
GTAAATAATACATAAAATAGGTAAATAAATCTTTAAAAAAACAACAACTTAAAAAAGAAACAAACAAACAATTCTCGGTG
CTCANAACTGACATACTGGTCACCCACTGAAAATGTTCCCTCTCATTAGGTGGGGTGGTGCACGCTGTAACCCTAGCTAA
AGCGGGGGCCACAAGCTTGAGGCCAGCCTAGGATACAGTGAGTTGTGCTTGGTAGCAGCCTGAGAAACAGAACCNGACTC
TATCTCAAAGGGGAAACAAAAGTTAAAGGTTACTCTCACCTGACATGTTAGCAAACACAATCTTANCACTTGGGAAGGCT
AAGGCAGGANGACCGCTTTGANTTCAGGCCNATCTGANACACACAGTAAAACTCAGTCTTAAAACAACAATANTNAATCT
NGGNTTNGGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125624790..125625281 468
 
EST/CDNA Est Name
  BI739407.1 - BI739750.1 - CJ124788.1 - CJ109445.1 - CJ124834.1 - CJ120901.1 - BB865430.1 - CJ107892.1 - CJ130493.1 - CJ064744.1 - CJ132535.1 - CJ056642.1

 
Come back to gene BI739407.1 - BI739750.1 - CJ124788.1 - CJ109445.1 - CJ124834.1 - CJ120901.1 - BB865430.1 - CJ107892.1 - CJ130493.1 - CJ064744.1 - CJ132535.1 - CJ056642.1


For any suggestions or comments, please send an email to unitrap@crg.es