Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A050E08
Clone ID A050E08
Vector pT1betageo
Project ggtc

Sequence tag A050E08
Sequence
TTTTTTNNATCAACCCCCCGTTTAATAATAAAGGGGGGGCAGGGCGGAGGGGAGGGGACACCACCCTCTTCCATGGGTTC
TCAGAAGCCAGTGGCTGAGGTGAAAAGTCTATGCAATATTTTTCATTTTCAGACTCCAAGCAGTTCCAGCAAACAGAGTT
GCAAGCTTACATTTAGTGAGAACAGGCCTACATCAGCTGCTTCTCCAGTGAATATTCTCTTGCCATCGCAGTCTATCTTT
GACACCTTCATTAAAGAGGTCTTAAAATGGAAATACCAAATGTTTTTGAACTTTGATAAGTGTGGTGCTCCAACAAGTCT
CTGTCAGTCTATCTCAAGGCCTGGGCCTGTCCTAATTCAAGATTGTGCAGAATATTCTGATGTTTTTCCACCTTTCATTA
GGTCGAAGGCTTTTGAGACAGTGGCACAGGAATGGCTGAGCTCTCCCAATACAGAGAGTTTAGATCAGTTGCAATTACGG
AAATTTCCNGGCCGTCTATAAAAAATACTGGGAGTTTATGG
Sequence Type mRNA
Unitrap ID UNI12233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29003874..29005626 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043535 (Setx) NP_932150 senataxin Gene [Source:MGI (curated);Acc:Setx-001]

 
Come back to gene ENSMUSG00000043535


For any suggestions or comments, please send an email to unitrap@crg.es