Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14722B8
Clone ID IST14722B8
Vector VICTR76
Project tigm

Sequence tag IST14722B8HMR1
Sequence
ACATCACGAAGTGAATGAATAGACAGAGTCAGCCAGGTAGTCGGTGTTCCTGAGCTGGTAGGGTGCTTGCTCAGCATTCG
TGAGGCCCTGGGTTCCAGCCCCACACTTAGGGCAGAAGCAGATCAGAAACTCAT
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157204299..157204432 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]


Sequence tag IST14722B8HMF1
Sequence
ATGTAACACTTAGGGATACCAAAGGCTGAAGAAAAAGAGACAGGCTAATGCCTGCTCTCAAAGCTCTGCTCCGAATGCAG
GCAGACAGCAGACCACAGAGCCAGGCTGCAGGGGGAGAGAAACTGTTCGGGAGACGGTTGATCTCATATGGGGTGGGAGG
GGAGACCTCTGTGGATGCCACAGGTCTTATAAAAGTAAACAGAGATGGGAACAGGGCANAAGTAGAGTGACTCACACTTG
NNNNNNNANGGAANAATATTCTAGATAGAAAGAAAAGCAGACTCCNNGGTGGGAAAGGGACCCACATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157203995..157204302 284
 
EST/CDNA Est Name
  W80148.1


Sequence tag IST14722B8BBF1
Sequence
ATGTAACACTTAGGGATACCAAAGGCTGAAGAAAAAGAGACAGGCTAATGCCTGCTCTCAAAGCTCTGCTCCGAATGCAG
GCAGACAGCAGACCACAGAGCCAGGCTGCAGGGGGAGAGAAACTGTTCGGGAGACGGTTGATCTCATATGGGGTGGGAGG
GGAGACCTCTGTGGATGCCACAGGTCTTATAAAAGTAAACAGAGATGGGAACAGGGCAGAAGTAGAGTGACTCACACTTG
TAATCTGAGGGAAGAATATTCTAGATAGAAAGAAAAGCAGACTCCAGGGTGGGAAAGGGACCCACATGGCCAGGAAGGGA
AACTGGAANATGCNGANATGGGATGGAACATAAACAAACCTTGGAAGACCNAGCCCCGTTTAACTTGNCNNAGTAAAAAN
TNANNCNNANANNNNCGCTNNGTTCTAANTTGCTCATTGTTGCTGTTATTTTATTNATTTATTTATTTACATTTNGGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene W80148.1


For any suggestions or comments, please send an email to unitrap@crg.es