Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A047F07
Clone ID A047F07
Vector pT1betageo
Project ggtc

Sequence tag A047F07
Sequence
CGCAAGCACGCAGGACCCATCGTCTCCGTGTGGNACCGCGAGCTCCGCAAAGCCAAAATCANNNAGAAAGCTTACTTTTC
TATACTTAGCAAATGATGTCATCCAAAACAGTAAAAGGAAAGGACCTGAGTTCACAAGAGAATTTGAGTCTGTGCTNNNG
GATGCTTTTTCTCATGTGCCAGAGAGGCAGATGAAGGCTGTAAAAAACCTTTAGAAAGATTGCTGAACATCTGGCAAGAA
CGAAGTGTGTACGGCGGCGAGTTCATACAGCAGCTGAAGCTGTCTATGGAGGACTCCAAGAGCCCTCCCCCCAAAGCAGC
AGAAGAGAAGAAGTCTCTAAAACGAACTTTTCAGCAGATACAAGAGGAGGAAGATGATGACTACCCTGGAAGCTACTCTC
CCCAAGACCCTTCTGCAGGCCCTCTCTTGACTGAGGAGTTAATCAAAGCTTTGCAGGATCTGGAAAATGCTGCGTCAGGG
GATGCTACTGTCCGACAGAAGATCGCTTCCCTGCCTCAGGAAGTGCAAGACGTGTCGCTGCTAGAGAAAATTACAG
Sequence Type mRNA
Unitrap ID UNI12239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157854730..157875949 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027651 (Rprd1b) NM_027434 regulation of nuclear pre-mRNA domain containing 1B Gene [Source:MGI Symbol;Acc:MGI:1917720]

 
Come back to gene ENSMUSG00000027651


For any suggestions or comments, please send an email to unitrap@crg.es