Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10845F12
Clone ID IST10845F12
Vector VICTR76
Project tigm

Sequence tag IST10845F12HMF1
Sequence
TGTAATCTCAGCACTCAGCATTTGGAAGCAGGAGACTCTGCANTTCAAGGTTCCATGAGTTTTTGAGCAAAGGTGGTATG
TAGCAAGGGTTGTGGGAAGAAAGGGGAGGGAGAAATTATATAATTATAATTTAATTTAAAAAAAAATTAAGGGGTAAACT
AGTTGAATGGA

Sequence Type genomic DNA
Unitrap ID UNI32978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 142476349..142476466 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038844 (Kif16b) NM_001081133 kinesin family member 16B Gene [Source:MGI (curated);Acc:Kif16b-001]

 
Come back to gene ENSMUSG00000038844


For any suggestions or comments, please send an email to unitrap@crg.es