Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15089B7
Clone ID IST15089B7
Vector VICTR80
Project tigm

Sequence tag IST15089B7HMR1
Sequence
GCTGTTTCTGAGTACCAGGAATATGTGTATTTAGAAGAGATTTAATCTTTGTTTCTGGCTGCTTTGCTTTGCGTCTCACC
ATGTAACCCTAGCTGAGCTTGAGCGCGTTGCTTTCCTGCCTCCATTTTCAGGTGCTGTAATTACAGCACGTGCCAGTAGG
CTGGCTGGAGATCGGACCCTTGTTCCTGTCTCCTCCCATTCTTCTTGGTGTGTCTGTACCATACACCAGTTGTGAAGACC
ATGCTGGACTTTGGCTCTGGGATAGCAAATGTCTACAACTAACTCCTTATCTTGGTTTTAATGAGAATCAGCTCAAACTT
TTCAAGAAAGCTGTGGGTGGTAGAACCCTCTTTGTTTCACTGTTTCTCCTT
Sequence Type genomic DNA
Unitrap ID UNI32979

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 18848564..18848934 371
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020160 (Meis1) NM_010789 Meis homeobox 1 Gene [Source:MGI (curated);Acc:Meis1-004]


Sequence tag IST15089B7BBF1
Sequence
TGAATGTTGCTGAAGTTTGGCTCTCCTGAAATTGGTCATGAGATGTTGGCTTGCTAGGTGAATTTAAGTGTGCTGAATGG
TGACAAGAATGTGTTAGTGGTTAACCACTGTGGACAGACTTCAGTGTTAGTCTACCCGTTAGCAGTCTCATGACAGCTAC
AGAAAGTTAAGAGAAGACAATGATTCAGCACTTGAAGAAAACGCCTCCTGCTCTGATGTGCTGCCTTCATTTTCCCATTC
GAAAGTGATCTCACTGCTGATAAAGCCGTCATTCCCGACAGCTCTTACTACCATCGCCACATTTAACCAAAGGACACTGT
GGCCTGAGTACCATGTCCGTGCAGAGCACAAACGGCAAACAACACATCTCAGCCNCACCACGCTGAACAAGCTCCAGCTC
ATCCAGGCCTGGAAGCGAAGCAAAACCGGGCATGGGTCATACTCCAATCGTACACAAGCTATGGACACCATGANAAAGAA
TTTTGGTTTCCATTAAGCNTTCCAANTGGAGGNCACAGAAGCTNNNCAACGTAATNNCNANGATAANTGGANNGTTGCAA
ACTCGTGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 18848937..18849505 539
 
EST/CDNA Est Name
  BG918622.1 - BU920388.1 - DT907052.1 - BI081853.1 - BY065248.1

 
Come back to gene BG918622.1 - BU920388.1 - DT907052.1 - BI081853.1 - BY065248.1


For any suggestions or comments, please send an email to unitrap@crg.es