Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14197D1
Clone ID IST14197D1
Vector VICTR74
Project tigm

Sequence tag IST14197D1HMF1
Sequence
GAGCTTCTGCAAAGTCCTGGGTTTGAGGCTGCAGCAGGGTGGCTGACAGGGAACAAAGGATTGTCAGCACCGGGGCGGGC
GGGAGGGCCAGCGGAGGACAGGCTCTGGAGAAAACACTTGCTTCTCACTGAGAAGGGGAAGGACCGGAAGTTGGGTTGTA
ACAGAACAGGGCACAGGGAGGCAGCTGGTCAGAGGGCCTCTCCGTTTTACCAGGAAGGCGGCCTAGAGCGCAGGGGAGCN
NTNNTGGGCATTCTGGAGAGCAAAGACCGACAGGAGGAATAATGTTCTAGCACCTCACCCAGAACACCAGGCGTGGGGCG
CTTCACGGAGCNNGGGTCCCCGGGGTTGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71022246..71022599 338
 
EST/CDNA Est Name
  BY370115.1 - BF471156.1 - BY244261.1 - AI427373.1 - BY261031.1 - BY248088.1 - BY270037.1 - BY291741.1 - BY260120.1 - BY259349.1 - CF169847.1 - BY288588.1 - CX123164.1 - DN174782.1 - BX529736.1 - BY277018.1 - BY262436.1 - BY275151.1 - BY250618.1 - BY250660


Sequence tag IST14197D1HMR1
Sequence
GCTCCATTCCTCCCGTGGACGTGGCCTTCTTCCCTCACTTCTCTGGGAGCCTCCTCACTTCCTCTGGCCTCTGGCTTTGC
TGGTCTTCCCTTCCCTTCAGCGTTTATTCCATACTTCATGTGATGTACTGACCCCTCCCCACCCCAAAGTGGGTCCTGGG
ATGGCATTCNACTTTCTTTCCCTGCTANCAATTTCNCATTTANACCCCTACCTCTAGGTCTGTGGGGCATGACCTCCTTT
TGGGGTCAGACNACCCTTTCACAGGGGTCACCTAAAACTAN
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71021970..71022249 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es