Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10909A4
Clone ID IST10909A4
Vector VICTR76
Project tigm

Sequence tag IST10909A4HMR1
Sequence
GGCTAGGTGAGTATTATTACATGGACATGTCTTCCCTAGTGTTCTCAGCACAGAGCAATCTGAGCAATTTTCTTATTACA
AACTTTCATGGTTCCTAGTTCTTTTTTTTTNNGGTTTTTTNGGGTTTTNTN
Sequence Type genomic DNA
Unitrap ID UNI31357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28994954..28995081 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043535 (Setx) NP_932150 senataxin Gene [Source:MGI (curated);Acc:Setx-001]


Sequence tag IST10909A4BBF1
Sequence
CCAATAGTTTTTGTAGTTGGTAGTATCATACATGTGTGCAGGCAAAAGGATCAGTTTGCCTTTTTCAAGCACAGAAGATG
TGTAAATGTCTGGACTTTCCAAAAGCCCCAGCTCAATGACTTTAAAAAGGCAAGTTAAAACTTCCTGTAAGTCATAATAG
TCATCTCTGTCCACCTTCCCCAGGTTTCTTGCAGTCNGAATAGCCCATCNNCNAACCTAAGTAATTGTATTATAAATAAC
ATTGTAGGTTCATTAATTCAATGAACAATGAACAAAGAAAATCTCCTAGTTACAGAGTTCANTANACTGATCAACCGGGG
ACTATATTACTGCATATAGACNTTCTTTAATCCTGATTCANACNNNCTACACATNATTNATGAAACANTCNTTCTCATTC
ATTTAAAGACTAGCANGAACCTGTTCTATGTNAATATCTATTTAACATTTTTATAAGCATTTGGTAATTTTTNCC

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28994484..28994955 438
NO GENE  

 
Come back to gene ENSMUSG00000043535


For any suggestions or comments, please send an email to unitrap@crg.es