Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A050E06
Clone ID A050E06
Vector pT1betageo
Project ggtc

Sequence tag A050E06
Sequence
CCCGGCGCACGGGCGTCTACGACGACTACGGGNGCGGCGGCGATCCTGCGGACGNNNNGAATGNNCGGGGATCTTTGCGN
ANNGCTCGCGGCGTGCTCGAGNNNNGGGNNNNACGGGNNNNGNNGCGCCGGCGTCCGNNNNGGGCGTAGGCATGNNGNCT
AGGCGGGTCGNNCGCNNCGCGCCNCGGGCGGCGCCGGTGGTGGCCTCCNNCTCTCTAAACCCCGCGGTGAGGGGGCCGAG
ATGGGGGATGTCATCCCACAGTTAGCTAAAGAACACCCTCATGTTTCATTTGTGAAGCTGGAAGCCGAAGCTGTTCCTGA
AGTATCTGAAAAATATGAAATTAGCTCTGTCCCCACCTTCCTGTTCTTCAAGAATTCTCAGAAAGTCGACCGGTTAGATG
GTGCACATGCCCCAGAGTTGACCAAAAAAGTCCAGCGACACGTGTCTAGCGGAGCCTTTCCTCCTAGTACTAATGAACAT
CTTAAAGAAGACCTCAGCCTTCGCCTGAAAAAGCTGACTCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCTCA
AGAACCACGCTGG
Sequence Type mRNA
Unitrap ID UNI12242

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 91472770..91473102 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049494 (AL805956.22)  

 
Come back to gene ENSMUSG00000049494


For any suggestions or comments, please send an email to unitrap@crg.es