Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11549H11
Clone ID IST11549H11
Vector VICTR76
Project tigm

Sequence tag IST11549H11HMR1
Sequence
NTACATGGGATGCTTAATAAAAATATATATTTATTATTTTATGCACATTGGTGTTTTGCCTGCATGTATGACTGTGTAAG
GGCCGTGTCAGATCCCCTAGAACTGGAGCCACGGACAGTTGTGAGCTGCCAAGAGGGTGCTAGGGATTGAACCCTTGTCC
TCTGGAACAGTAGCTAGTACTCCAAACTTCTGAACCATCTCTCCAATCCATAACAATGTATATATTTTTTAATACCTTAA
ATCAGTGACTACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32982

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 103689181..103689435 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033004 (Mycbp2) NP_997098 MYC binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2179432]

 
Come back to gene ENSMUSG00000033004


For any suggestions or comments, please send an email to unitrap@crg.es