Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14554F5
Clone ID IST14554F5
Vector VICTR74
Project tigm

Sequence tag IST14554F5HMR1
Sequence
NNGGACNNGATGGATTTGAATCCTTTTTGTTGTCNCTTAACAAACGGTGACTCTNTAAAATGGAAGCAATATGTACTTGT
GAGTGCTGGAAAGTTTGTTTTAATCCTCTAAAGCTCTTAAAGGTCAGGCACATACATGTCTGCACTCTTGGTACTTCANA
GGCTGAGACTGGAGGACAGTCATTCTGTGAGGGTATCCTCTGCATAGCAAGTACCANAGTATCTGTGATCTTAAAGTAGT
ATCTGTCCCATAGTAAGACAGTGTATGTTTACTGCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI15223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41203993..41204269 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es