Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A051E01
Clone ID A051E01
Vector pT1betageo
Project ggtc

Sequence tag A051E01
Sequence
CTTCCCCGCCGCAGGGACAGGNNCAGCGCCGCCATCAAACTCCNNNAGGTCAGGGGGGCGCGCGCACGCCGCCGTCTACG
TCGTGGCGAGCGAGGCCGCACGGCTTCGTCCAAGGGGCGGGGCTGTCAGTCAAAGTGCACAAGCTGCTGAGTGAAGAGAG
ACTTCTACTGGAGGGAATGGCCGCCTCCTCGTCTTCGTCTTCAGCTGGTGGGGTCAGTGGAAGCTCTGTCACCGGATCTG
GTTTCAGTGTGTCCGACCTTGCCCCACCTCGGAAAGCTCTGTTCACCTACCCTAAAGGAGATGGAAAAATGTTAGAAGAT
GGCTCCGAGCGATTCCTCTGTGAGTCGGTGTTTAGCTATCAAGTGGCATCCACGCTTAAACAGGTGAAGCATG
Sequence Type mRNA
Unitrap ID UNI12249

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 59453581..59465852 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020107 (D10Ertd641e) NM_025514 UPF0448 protein C10orf104 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q9CPV2]

 
Come back to gene ENSMUSG00000020107


For any suggestions or comments, please send an email to unitrap@crg.es