Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14977F4
Clone ID IST14977F4
Vector VICTR76
Project tigm

Sequence tag IST14977F4HMR1
Sequence
ATTGAGGGACCTGAGTTGATGAATCTTCCCAGATCAGCCCAGCGTGACCTCCCAGAACTCTGCTAAGGCTCGCACGTGCC
CCAGCTGGCATT
Sequence Type genomic DNA
Unitrap ID UNI5891

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107490348..107490439 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010048 (Ifrd2) NM_025903 interferon-related developmental regulator 2 Gene [Source:MGI Symbol;Acc:MGI:1316708]


Sequence tag IST14977F4HMF1
Sequence
CAATGACATCGAAGGGGAATCACGGAACACCCCCGCTCACTACTGAACAAGTCTACTGGAGCCCCCGGACTCACCTCCTC
CACGGCGCTGACCGCCCTTGCGGAGCGCATTGCCCTTCCGAGCACGAGGCATTCCTGGAACCGAGAATTGGGAACACGGG
AATGGGGCGCGGGGTCAGGGACCCGGAGGGCGGGGACTCCAAACCAGCGAAACGCTGGCCCGTGTGCTGAGCTGAGACTG
GCGAGGACGACAGGAGCCACACGCCGCGCGCGCCACCATCTTCGTGAGGCGCCCCGCCCTGTCNAATGGGTCGCTGGGAA
GGTGANTTNNCGGCCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107490015..107490351 329
NO GENE  

 
Come back to gene ENSMUSG00000010048


For any suggestions or comments, please send an email to unitrap@crg.es