Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12243C6
Clone ID IST12243C6
Vector VICTR76
Project tigm

Sequence tag IST12243C6HMF1
Sequence
GGAGCGAACACAGTGCCTACTCTGTGGTGATGCATCCTGCTCAGGGA
Sequence Type genomic DNA
Unitrap ID UNI17054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93983399..93983445 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047109 (Cldn14) NM_019500 claudin 14 Gene [Source:MGI (curated);Acc:Cldn14-001]


Sequence tag IST12243C6BBF1
Sequence
GGAGCGAACACAGTGCCTACTCTGTGGTGATGCATCCTGCTCAGGGAAAAAAAAAACCCNNNNAANGGCCCCCCANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047109


For any suggestions or comments, please send an email to unitrap@crg.es