Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14769E9
Clone ID IST14769E9
Vector VICTR76
Project tigm

Sequence tag IST14769E9HMF1
Sequence
CACGGAGATACAATTTCTCTCTTTTTTGTCTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTTGAATT
AATAACTAGTTA
Sequence Type genomic DNA
Unitrap ID UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52079197..52079287 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 87789267..87789357 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24048324..24048414 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124749633..124749723 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91356539..91356629 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940229..136940319 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919902..52919992 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469503..7469593 91
NO GENE  


Sequence tag IST14769E9HMR1
Sequence
CGTGCATACTATTTAGTGCATTCCCATGCACACTATTTAAGTCTTACCTTTATTTTCAAAATCTAATATTTTAATGTCAA
AGAGTTTAATAAATGCTTTATAGTATCTTAAAGGGATCTACTTATTGGCTTATAGATTGATCCTAAAACAGCTACCTTAT
TAGAAAAGGGAAAAACAGGTTTTCTCCACAAAACGCTTCAAAAACATATTAATTCGTGTGACGAGCTGGTANGTAANTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115777221..115777459 235
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940316..136940554 235
 
EST/CDNA Est Name
  BI789805.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919667..52919905 235
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469590..7469828 235
NO GENE  

 
Come back to gene BI789805.1


For any suggestions or comments, please send an email to unitrap@crg.es