Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10421H4
Clone ID IST10421H4
Vector VICTR76
Project tigm

Sequence tag IST10421H4HMF2
Sequence
GCATGTCTTTAATTCCACCGCTTGAGAGGCAGAGGCNAGTGGATCTCTGTGAGTTTGAGATCAGCCTGGTCTACAG
Sequence Type genomic DNA
Unitrap ID UNI11698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123375450..123375525 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]


Sequence tag IST10421H4BBF1
Sequence
GCATGTCTTTAATTCCACCGCTTGAGAGGCAGAGGCAAGTGGATCTCTGTGAGTTTGAGATCAGCCTGGTCTACAGAGTT
CCAAGACAGCCAGAAACTTTGTTTTGAAAAACCAAAAAGGAAATAATAATAATAATCAGAAGCAAGTAGATTTCTGAGTT
CAAGGGCAGCCAGATATACATAGCCATGTCCTTAAATAANAAAGCAGTTTTATTAATACCTNATTTTTTNNNNNNTTTTC
TTCTTTTTGGGGGGGGGGCNAAAAACCCTTTNNNNNNNGGGTTNNTNTGNNTANCCCTGGCTGNCCNGGAACTNANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es