Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14595E8
Clone ID IST14595E8
Vector VICTR74
Project tigm

Sequence tag IST14595E8BBF2
Sequence
NNANTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI4639 UNI12836 UNI31310 UNI32988 UNI32989 UNI32990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 2062..2107 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 158105..158150 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069661 (AC140325.3-201)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 144675..144720 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3566165..3566210 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024908 (Saps3) NM_029456 SAPS domain family, member 3 Gene [Source:MGI Symbol;Acc:MGI:1921807]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5350876..5350921 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3300596..3300641 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4805980..4806025 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5199914..5199959 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12405565..12405610 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052374 (Actn2) NM_033268 actinin alpha 2 Gene [Source:MGI (curated);Acc:Actn2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3714245..3714290 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6509689..6509734 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3250015..3250060 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14648997..14649042 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7388920..7388965 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11577094..11577139 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29222232..29222277 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6339200..6339245 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5050175..5050220 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028926 (Pftk1) NM_011074 PFTAIRE protein kinase 1 Gene [Source:MGI (curated);Acc:Pftk1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4557837..4557882 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8960364..8960409 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027506 (Tpd52) NM_001025261 tumor protein D52 Gene [Source:MGI (curated);Acc:Tpd52-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7584798..7584843 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4815597..4815642 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6988161..6988206 46
NO GENE  


Sequence tag IST14595E8HMR1
Sequence
TTTACATATAATAATAAATAAATCTTAAAAAAATGCATAATAAATGAAAAATATAACCNGTCTTCTTGGAACTCCTTTCC
AGTAACTCAGACTGAAGACTAAGCTAGCTGCAAAGTTACAGTGATCCACCTCCCTCTGCCACCACCACCACCACTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es