Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12644C10
Clone ID IST12644C10
Vector VICTR76
Project tigm

Sequence tag IST12644C10HMF1
Sequence
GAAATGACTTGGAGATGCCTGATATTCCGTGGCTTAGTGTTGATGAAGGGATTTTAAGACTTAGGGAAATTGCAATGCTA
GAGTGGATATATTGTGTAAAGCATAATTGTCCACAATGGGAAGGTCCAGAANATATGCCTTTCACCANCTCTATAAGACG
CANATTGGTGANAGGGGCNCCANCNCATTTGAAGGGTTTTGTTNNTTNNNTTTN
Sequence Type genomic DNA
Unitrap ID UNI22305 UNI31003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 46556..46758 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3162927..3163129 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 37549362..37549564 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8525666..8525868 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3765803..3766005 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 18988643..18988845 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6941120..6941322 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12867792..12867994 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7487100..7487302 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8049780..8049982 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46369696..46369898 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4761524..4761726 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 31092626..31092828 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 37925319..37925521 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11608428..11608630 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22073492..22073694 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34461671..34461873 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9312133..9312335 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39241260..39241462 189
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 68757366..68757568 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027035 (Lass6) NM_172856 LAG1 homolog, ceramide synthase 6 Gene [Source:MGI (curated);Acc:Lass6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11249397..11249599 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048960 (Depdc2) NP_001028808 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc:MGI:1923385]


Sequence tag IST12644C10BBF1
Sequence
GAAATGACTTGGAGATGCCTGATATTCCGTGGCTTANTGTTGATGAAGGGATTTTAAGACTTAGGGAAATTGCAATGCTA
GAGTGGATATATTGTGTAAAGCATAATTGTCCACAATGGGAAGGTCCAGAANATATGCCTTTCACCANCTCTATAANACG
CAAATTGGTGAGAGGGGCACCANCACATTTGAAGGGTTTTGTTCTTTCCCTTTTCCTTGTGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 46556..46778 213
NO GENE  

 
Come back to gene ENSMUSG00000048960


For any suggestions or comments, please send an email to unitrap@crg.es