Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11537B11
Clone ID IST11537B11
Vector VICTR76
Project tigm

Sequence tag IST11537B11HMR1
Sequence
ATATCTAGAAACATCCCGACATTGCAGATATCCTGGGGTAGGGGAGAGAACTATCTCTGGCTGAGAACCNCACTTTAACC
NGATTCACCACCAGGACACCTGCGCCTTCCTTCCCTTTGTTCCAGCTTAAGTGGATGGAAGACATATATATATAAATGAA
TATAAGGCTTTTATAAATCAGGAGTCAAAATCCACTTCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99312987..99313189 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]


Sequence tag IST11537B11BBF1
Sequence
GTTCAGAGACATCGCTTAAACATTCTAGAAAGCACANGGNGGCCTTCCCCAAGAGGCCTCCCAGCTAAGGCAGAGAGGAG
AGAGCTGGAAATGTGGGAGGCCGGTTCGGAAGAATGATGGGGTCTTCACAGGTCANGACTGACTGTGAAGAGGTGACNAA
GAAGGGTGTAGAGTAAGTGACTTTGGGAAACAGTGCCACAGAGTGCCNCANAGAGAGTCNAGCAGGGGTCATGGAAGGCA
CACTCAAAAAACCAANAAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99313211..99313474 248
 
EST/CDNA Est Name
  BY309786.1 - BY323181.1 - BY008155.1 - BY327691.1

 
Come back to gene BY309786.1 - BY323181.1 - BY008155.1 - BY327691.1


For any suggestions or comments, please send an email to unitrap@crg.es