Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14406E1
Clone ID IST14406E1
Vector VICTR74
Project tigm

Sequence tag IST14406E1BBF1
Sequence
CCGTCCAGCAGANAGCCGAAAGAAAAGTGCCAAGGGTGGGAAACTGCCCCCTCCCTATCCCGTTTGGATACTAACCCATC
CTCCCTGCTCCAGTTCCCAAATGCACTTGCTCTGATCTTCCAGGCTCCAGAATCTTACTTCTTTTCTTCTCCCCTAGGCA
TGTACTCCTGTCCCTGCTATTATTATCCCAACCGGGCAGGCAGCACAGATCGAGCCTCCTTTGTCATAGGCATCGATCTC
CGATCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32991

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69234556..69234806 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005237 (Dnahc2) NM_001081330 dynein, axonemal, heavy chain 2 Gene [Source:MGI (curated);Acc:Dnahc2-001]


Sequence tag IST14406E1HMF1
Sequence
GGGGCATTCTCTTCAAGAACAAAACAACAGTGTACTTTATCTGATCTATTTACAGGTCCTGATGAAAGCAAACTGTAGGA
AAAGGTTTTCAAAGTAAATCAACAGCCCTGCTGCCTCTTTTCTTGTGTGAGGCTGCGTGAGTACCAAAGCACCAGCGCCC
TGGCACCTATGGAGGTCAGAGGACGGCCTGGAGGACTCAGTTCTTCCCTCCCACCATGTGGGCTGCAGAGCCTGACCTAT
CTCTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46945946..46946194 249
 
EST/CDNA Est Name
  AI466036.1 - AA822777.1 - CA876267.1


Sequence tag IST14406E1HMR1
Sequence
GCCCCCTGTCTCTCGAGACAGAAAAACCGCTTGTATGTGGACTGTTATTGGACTGTTGCTAGCCAGTGGTCANCCATTGC
TGTGGTCTCTCCAAACACCCACACTGAGGCCTGGTGGGAAAACTACGGGTTTGTTTGTTTTTTGTTTTGGGTTTTTTGTT
TTTTGTTTTTTGTTTTTTTTTGGTTTTTGTTTTGTTNNGNTTNNNGTTTN
Sequence Type genomic DNA
Unitrap ID UNI6164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46945742..46945950 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036568 (BC032203) Uncharacterized protein KIAA0240 [Source:UniProtKB/Swiss-Prot;Acc:Q8CHH5]

 
Come back to gene ENSMUSG00000036568


For any suggestions or comments, please send an email to unitrap@crg.es