Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14369E3
Clone ID IST14369E3
Vector VICTR74
Project tigm

Sequence tag IST14369E3HMR1
Sequence
TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTGTT
Sequence Type genomic DNA
Unitrap ID UNI31803 UNI32216 UNI32992 UNI32993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161906: 25798..25857 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161916: 681782..681841 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 320342..320401 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 406602..406661 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13586555..13586614 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 28587164..28587223 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24441038..24441097 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035435 (Abca17) NM_001031621 ATP-binding cassette, sub-family A (ABC1), member 17 Gene [Source:MGI (curated);Acc:Abca17-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 34887487..34887546 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022836 (Mylk) NM_139300 myosin, light polypeptide kinase Gene [Source:MGI (curated);Acc:Mylk-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8314403..8314462 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022141 (Nipbl) NM_027707 Nipped-B homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913976]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21306271..21306330 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 77612259..77612318 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77575084..77575143 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 27395817..27395876 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56233984..56234043 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 44982995..44983054 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6252002..6252061 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18956394..18956453 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19240959..19241018 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070796 (AC165084.6) NM_027403 pregnancy-specific glycoprotein 21 [Source:RefSeq peptide;Acc:NP_081679]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20144409..20144468 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55459176..55459235 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 64274577..64274636 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 55425145..55425204 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 87894806..87894865 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6998778..6998837 60
NO GENE  


Sequence tag IST14369E3HMF1
Sequence
GCAGTGGTGGCACATGCATTTAATCCCAGCACTTGGGAAGCAGAAACAGACAGATTAGGGTTCAAGGCCAGCCTGGCCTA
CAGAGTGAGTTCCAGGACAGCCAGTGTTACACAGAGAAACTGCATCATGAAAAAGAAACAAAAAACAAAAATGAATTAAA
TAAATACAATTAAAAAATTAAAAAATTAAAAAATACCGGGGAGTGGTGGCTCAAGCTTTTAATCCCAGCCCTAGGGAGGC
AGGGATGGGAGGATTTCTGAGTTTGTGGCCAGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000070796


For any suggestions or comments, please send an email to unitrap@crg.es