Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A051B04
Clone ID A051B04
Vector pT1betageo
Project ggtc

Sequence tag A051B04
Sequence
AGTTTACNNNAGCACCAGCTGCGAATCCAGGACCAAGAATTCCAGCAAGGCTCTGATGGCGGCTGGTGCCTGNNNATGCA
TCAGCCNNNGGCTTCTCGGCGGGGCGGGGGGATTAANNNGGGTGGAGGGCAGATCCTGGTATACTCCTCACAGAGGAAGA
CTTTGGATAGCAGCCACGGGCAAAAGACCTTCCCCTCAGGAAGTCTCAGAACTCCAGGCTACCGATCGTCTTCTTCGTGG
GAAAGATGTGGAGTTTACAAATGCCTATCCGTCGGGTTGTGTTCTGGACTGTGTGCCCCCAATTAATTGCATGTCCCAGA
AGCAATTTCAGGAGCAGTTCCCAGACATCAGTCAAGAGTCTGACTCTTCATCTGTTTTCATTTGCAAAGGTCCGCAGGAA
ATGGTTGTGAAGTTCCCTATTAAAGGAAATCCTAAAATCGT
Sequence Type mRNA
Unitrap ID UNI12257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65686743..65705249 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032386 (Trip4) NM_019797 thyroid hormone receptor interactor 4 Gene [Source:MGI (curated);Acc:Trip4-001]

 
Come back to gene ENSMUSG00000032386


For any suggestions or comments, please send an email to unitrap@crg.es