Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A051D08
Clone ID A051D08
Vector pT1betageo
Project ggtc

Sequence tag A051D08
Sequence
ACNNNGAGTANCNNCCATGGCCCGAATTCTGCAAATAGCAGAGTCTTACTTGGTGGTCAGTGCAAGGCGCGAGATGCAGC
TGCTGTCCTTGTGTCCAAATTTATCACACGTCCTGATGTCAAGCAGAGAAAGATGGCCAGCTTTCTGGACTGGAGCCTTT
GCACCTTGGCCCACTCTTCCTTCCAGACCATCGAGGGTGTCATTACCATGGATGGGATGCTGCAGGCCCTGGCTCAAATA
TTTAAGCATGGAAAACGTGAAGACTGCCTTCCCTATGCCAACACTGTGCTCCAGTGCCTCGACGGCTGCAGACTCCCCGA
GAGCAGTCATACCTCGCTGCGGAAGCTTGGTGTGAAGCTTGTCCAGAGGCTGGGGCTGACTTTCCTGAAGCCAAAGGTGG
CCACGTGGAGGTATCAGCGTGGCTGTCGGTCTTTGGCTGCTAACCTGAAGCTCTGTGCCCCGGGTAAGAGTGACCAGAAG
CTGCTGTCTGATAGTTTGACCTCTGATGGTGATGAAGACTATGATGTCCCAGAGGGGGTAGAAACTGTGATAG
Sequence Type mRNA
Unitrap ID UNI12259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121322677..121358451 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039230 (Tbcd) NM_029878 tubulin-specific chaperone d Gene [Source:MGI (curated);Acc:Tbcd-001]

 
Come back to gene ENSMUSG00000039230


For any suggestions or comments, please send an email to unitrap@crg.es