Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A034C02
Clone ID A034C02
Vector pT1betageo
Project ggtc

Sequence tag A034C02
Sequence
AGGCTTTTGNNCCCCATGTATATTTATATCAGTCATCCCAAANNNGAAGGCCTGGCTGCTGCCAAGAAGNNTTGCGAGAA
TCTCTTACAAACAGTTCATGCTGAGTATTCTAGATTTGTGAATCAAATTAATACTGCTGTACCATTACCAGGCTATACAC
AACCCNNNGCTATAAGTAGTATCCCTCCTCAACCACCATATTATCCATCCNNNCCGCTATCAGTCTGGTTACCCTGTTGT
TCCCCCTCCTCAGCAGCCAGTTCAGCCTCCCTACGGAGTACCAAGCATAGTGCCACCAGCTGTTTCATTGGCACCTGGAG
TCTTGCCAGCATTACCTACTGGGGTCCCANNNGTGCCAACANCGCCCCCGATACCACAAGTGCAACCTCCAGCCAGCACT
GGACAG
Sequence Type mRNA
Unitrap ID UNI12261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88502756..88504436 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]

 
Come back to gene ENSMUSG00000028060


For any suggestions or comments, please send an email to unitrap@crg.es