Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14375F3
Clone ID IST14375F3
Vector VICTR74
Project tigm

Sequence tag IST14375F3HMF2
Sequence
GTATCTGTGGAAAAAATGATGAATGAAAGGAAGGAGTTGTGTGATAAAATCGAAAGGCTCCAGACACAAGTAAACGATCT
AAAAGTTGCTAAGTGTGTCCTTGAGGAGAATCTTCTCTCTTGTAGCAATAGAGCTCAAGTTGCAGAAAATCAAACAGAAA
CTCTCATTGTAAGGTTGGCTGAACTACAGCGAAAATTCAAGTCTCAGCCTCAGAGTGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI31001 UNI31002 UNI31003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 45779..45999 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 44293779..44293999 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025202 (Scd3) NM_024450 stearoyl-coenzyme A desaturase 3 Gene [Source:MGI Symbol;Acc:MGI:1353437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 53993855..53994075 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9923906..9924126 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11334229..11334449 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 18987868..18988088 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 28713341..28713561 221
 
EST/CDNA Est Name
  BE333375.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37792072..37792292 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7486325..7486545 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8049005..8049225 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26548096..26548316 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51926352..51926572 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 77700402..77700622 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 61729578..61729798 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079548 (AC125119.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11410934..11411154 221
 
EST/CDNA Est Name
  AI505898.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7526277..7526497 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 70134141..70134361 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 6910714..6910934 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 48920623..48920843 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34785625..34785845 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11248622..11248842 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048960 (Depdc2) NP_001028808 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc:MGI:1923385]


Sequence tag IST14375F3HMR1
Sequence
NNCTAAGAGCAGCNNGCNAGTAAAATNATTTTTCGATTTTTTCCCCATCTTGTAGAAAGCTTTGTGCACTGAATCACCTA
ATTCATTAAGAAAATCAAGGGCATTAGCTTCTTTAAGTTCGGAATATAGTTTCAACCATGGGTCTTCAAAATTCTCTGAG
CTCCCAGGAGGGAGAGAATCTGGAGAGGTTTCAATAGTTGAAAGTGCTGGTGGATCAACAANCCAATTCCANAATTTTAA
AAGATTCATCCTTGTACTTCTGTTACTCTANAACCACTCCTGGTACCAACTTCTGTATTANTCAGGGTTCTCTANAGTCA
CANAACTTATGGATAATTTCTAAATANTAAAGGAATTTANTGANGACTTACNNTCNGCNGCNNAATTCCCNNCNNTGGTT
CNNTCGCANCTGTGAATGGAANTCCNNNGATCTANCNNTTACNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14375F3BBF1
Sequence
GTATCTGTGGAAAAAATGATGAATGAAAGGAAGGAGTTGTGTGATAAAATCGAAAGGCTCCAGACACAAGTAAACGATCT
AAAAGTTGCTAAGTGTGTCCTTGAGGAGAATCTTCTCTCTTGTAGCAATAGAGCTCAAGTTGCAGAAAATCAAACAGAAA
CTCTCATTGTAAGGTTGGCTGAACTACAGCGAAAATTCAAGTCTCAGCCTCAGAGTGTGTCGACAGTTAAAGTAAGGGCT
CTAATTGGCAAAGAATGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 45779..46040 262
NO GENE  

 
Come back to gene ENSMUSG00000048960


For any suggestions or comments, please send an email to unitrap@crg.es