Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A033E02
Clone ID A033E02
Vector pT1betageo
Project ggtc

Sequence tag A033E02
Sequence
GGACNCCGTACGCAGGCGCGTGCGGCGTGGGTCTAGCATCCTTTCTGCTGGAAAAGGAAGCGGCGGCCCTCTCAGAACGG
CGGAGGCGGCCTGAGCCTCGCCATTCGCTGAGGCATCCGCGGGCGGGAGGCCGCAGTCTAGACCCCCGACGCGCGCCGCG
CCAACGGTCCGCCACTCGTGCTGCTTTCCACGGAGAGGGCGAGGAGTAGGGGCCGGCGGTGGATATGGAATTCATTGGGA
AAGAGGAACCGAAA
Sequence Type mRNA
Unitrap ID UNI9754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109833985..109834200 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es