Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A053B03
Clone ID A053B03
Vector pT1betageo
Project ggtc

Sequence tag A053B03
Sequence
TCCANNNGCTGTGCGGGTTGCGGTACAAGATCCCNNNGGTGGTGGTGGAGAAGGACGCAGTGTTTATTCCAGCAGGGTGG
GATAATGATAAGAAAATAGGAATATTACATGAAAATTTTCAGACTTTGAAAGTAGAAGATAATTTTGAAGACATCATAAC
CAAACCTCCTGTCAGAAAGTTCGTGCATGAGAAGGAGATCATGGCAGAAGATGACCAAGTGTTTCTGATGAAGCTACAGT
CTCTTTTAGCAAAGCAACCTCCAACTGCAGCTGGAAGGCCTGTGGATGCATCACCAAGAGTCCCTGGAGGCTCCCCTCGA
ACACCAAACAGATCTGTGTCATCCAATGTTGCCAGTGTGTCCCCCATCCCTGCTGGATCCAAAAAAATTGATCCAAACAT
GAAAG
Sequence Type mRNA
Unitrap ID UNI10042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114624281..114629787 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032435 (Dync1li1) NM_146229 dynein cytoplasmic 1 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:2135610]

 
Come back to gene ENSMUSG00000032435


For any suggestions or comments, please send an email to unitrap@crg.es