Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12567A6
Clone ID IST12567A6
Vector VICTR76
Project tigm

Sequence tag IST12567A6HMF1
Sequence
CTTGAACCCAGGTCCTCTGGAAGAGTGTTTTGTGCTCTTGACTGCTGAGCCATCTCTCCAGCCTCCCTTCTTTTCACTTT
TTTGAAACCTTATTTTACTTACTAGCCCAAGTAGTCCTTGAACTTGTGGTCCTCAGTCTTGAGTCTCCTGAGTACCTTGG
GGTACATGTATGCACCAGATTAAGGGTCCTGAACTAATTTCANAGATGTGGTGAGGCCNTNANANNTNNGGGTGGANGNG
NNANAC
Sequence Type genomic DNA
Unitrap ID UNI30044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10300781..10301016 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]

 
Come back to gene ENSMUSG00000036098


For any suggestions or comments, please send an email to unitrap@crg.es