Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14424C1
Clone ID IST14424C1
Vector VICTR74
Project tigm

Sequence tag IST14424C1HMR1
Sequence
GTTGGAGATGGGAAATCCCACGTTAGTGTAGTGGACAGTGTGAATACTTTTGCTCAGGCCGGTGGGTGAGTCATGTGCCT
CTGCTGATTGGCTGACCTCCCTGTTACTCAAGACAAGGGTTTTTTTGTTTGTTTTTTTAAAAGTGTTTTTAGCCTGCTTG
TTTACTTGTTTATGCTTTTCGAAATCTGGTGAGATTATCTCCTGTGTGTGTATATATGTTGGATGCCANTTGCANCANCC
CTCTTGANAATGTCTTTACTTATCATCAAAGGTGATATTAATANCCCCTGGTTACTAAAATCCAACTCTCAGTGTACTTC
TAAGCCAATGTGCTCTTCANTGCTATAATAAAAAATTGGAAAATTTTTATNANTGNNNATGTCC
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32420103..32420485 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


Sequence tag IST14424C1HMF1
Sequence
CAACCCAGCTCGGCCTTGGGGGCTTCTTGTTTAAGTGCTATTTCCGTGTTTGTGTGTAAGGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32420482..32420551 70
NO GENE  

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es