Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12871H1
Clone ID IST12871H1
Vector VICTR76
Project tigm

Sequence tag IST12871H1HMF2
Sequence
TTGGCAGCTTTAATAATGTTCTTATCACCCTGGAGACCAGGCGGGCTGTGGAGGTCGGCCTTCATTAGCACATGCTCATC
TGTAATCCGGGGACATTCTCATTTGGGGCACACTGTTGTTCATGCTGCCTGTAGAGTCCTTAGGGTATTAGGTAGCAGGG
ACCCCACTTCCAGAAGGTTGTTCTGAGTCTGCCACTGACCAGTTGGACCAGTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI8136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28085793..28086009 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]


Sequence tag IST12871H1BBF1
Sequence
TTAGCTTTCACTGTTCTTCACTCCTTTGCTAACCTCAAAGCTCCAAAACGCCTGTCTTCAACCCTACTTCTCTACAAGCT
AGAGTCCCTCAAGACCAACAGACAACTTTCTAACTCATATATCTCTAAAGACTTCCAACTCACAGGCTGCAGTCCGACTC
ACGTGGGGGGCCTTCTAGCCTAAGTCCTCGGTGACTTCTCTTGTGCCAATATCTGATGCTCTGTCCATCTAAGAGCAGAA
GGCAGAGACCTAGCAGTGACCTGCTACATTTTTCTATTGCAATTCGAAAAGCTATCTCAAATTTACCGCTTACTCAAAAT
TACGATGCTAATATTAGTTTGCTCACAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI7424

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 168066111..168066461 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000544 (Gpa33) NM_021610 glycoprotein A33 (transmembrane) Gene [Source:MGI (curated);Acc:Gpa33-001]

 
Come back to gene ENSMUSG00000000544


For any suggestions or comments, please send an email to unitrap@crg.es