Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12868D7
Clone ID IST12868D7
Vector VICTR76
Project tigm

Sequence tag IST12868D7HMF2
Sequence
ACATGGTGGCTCACAACNACCCATAATAAGATCTGATGC
Sequence Type genomic DNA
Unitrap ID UNI17278 UNI31176 UNI33001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 59257612..59257650 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30389523..30389561 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062202 (Btbd9) NM_172618 BTB (POZ) domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:1916625]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48365365..48365403 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117562891..117562929 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 115541104..115541142 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 75080946..75080984 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86838153..86838191 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057230 (Aak1) NM_177762 AP2 associated kinase 1 Gene [Source:MGI (curated);Acc:Aak1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107107177..107107215 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88409812..88409850 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 147350477..147350515 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153276893..153276931 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061411 (8430427H17Rik) NP_001127772 RIKEN cDNA 8430427H17 gene Gene [Source:MGI Symbol;Acc:MGI:1918765]


Sequence tag IST12868D7BBF1
Sequence
ACATGGTGGCTCACAACCACCCATAATAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI17278 UNI31176

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7880502..7880536 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116565518..116565552 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54887560..54887594 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81264807..81264841 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48365369..48365403 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30389527..30389561 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062202 (Btbd9) NM_172618 BTB (POZ) domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:1916625]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 59257612..59257646 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 129607354..129607388 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88409816..88409850 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115915454..115915488 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86838153..86838187 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057230 (Aak1) NM_177762 AP2 associated kinase 1 Gene [Source:MGI (curated);Acc:Aak1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107107177..107107211 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 40991731..40991765 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 115541108..115541142 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 147350477..147350511 35
NO GENE  

 
Come back to gene ENSMUSG00000057230


For any suggestions or comments, please send an email to unitrap@crg.es